24-03-2024 08:27
Thierry BlondelleHiOn Hedera helix fallen branchEcological habitat:
26-04-2024 10:07
Mathias HassHello, Does anyone know what this is? Found on J
24-04-2024 21:54
éric ROMEROBonjour, J'ai trouvé ce Lasiobolus sur laissées
23-04-2024 15:18
Lothar Krieglsteiner... but likely a basidiomycete. I hope it is o.k.
23-04-2024 13:17
Edouard EvangelistiBonjour à tous, Je viens de récolter ce que je
23-04-2024 21:49
Ethan CrensonHello all, A friend recently found this orange as
22-04-2024 11:52
Zuzana Sochorová (Egertová)Hello,I made a loan of a collection of Microstoma
11-01-2022 16:36
Jason KarakehianHi does anyone have a digital copy of Raitviir A (
22-04-2024 20:38
Miguel Ángel RibesGood afternoon.Does anyone know this anamorph?It g
Pezoloma marchantiae?
Georges Greiff,
08-12-2021 00:12
A couple of colleagues collected a whitish disco from living thalli of the liverwort Marchantia polymorpha (subsp. ruderalis). I think this is Pezoloma marchantiae.
Ascospores lacking guttules with dark spots near the ends (nuclei?). In water, n=20, averaging 8.65 x 4.3. Asci 8-spored, in IKI tips with a faint reddish band.
I have put some photos in the comments below. Please let me know if there is more information that would help to confirm the ID.
Thanks,
George
Edouard Evangelisti,
08-12-2021 07:59
Re : Pezoloma marchantiae?
Hello George,
In case thay may help, you can find here a paper on Pezoloma as well as a key. Sorry I don't get the original publication. I am curious, is this similar to the collection you are sending us in Cambridge?
Cheers,
Edouard
In case thay may help, you can find here a paper on Pezoloma as well as a key. Sorry I don't get the original publication. I am curious, is this similar to the collection you are sending us in Cambridge?
Cheers,
Edouard
Georges Greiff,
08-12-2021 09:53
Re : Pezoloma marchantiae?
Hi Edouard,
Yes, it is the same. I am wanting to get external confirmation of the ID because P. marchantiae does not seem to have been recorded in the British Isles previously, whereas several people on here are famiiar with it from mainland Europe. Hope the specimen arrives safely!
Will add photos here shortly.
George
Yes, it is the same. I am wanting to get external confirmation of the ID because P. marchantiae does not seem to have been recorded in the British Isles previously, whereas several people on here are famiiar with it from mainland Europe. Hope the specimen arrives safely!
Will add photos here shortly.
George
Enrique Rubio,
08-12-2021 11:20
Re : Pezoloma marchantiae?
Georges Greiff,
08-12-2021 11:25
Re : Pezoloma marchantiae?
Thanks Erique,
I saw your great photos and I think our specimen agrees. The spore lengths I measured were slightly longer, on average, but some may have been overripe. It agrees with the measurements in Benkert 1981.
George
I saw your great photos and I think our specimen agrees. The spore lengths I measured were slightly longer, on average, but some may have been overripe. It agrees with the measurements in Benkert 1981.
George
Enrique Rubio,
08-12-2021 11:33
Re : Pezoloma marchantiae?
Sorry, I had called you Bernard instead of Georges.
Georges Greiff,
08-12-2021 12:06
Re : Pezoloma marchantiae?
Thanks Enrique. Would you be willing to agree with the ID here? I am not aware of any similar species on Marchantia.
Enrique Rubio,
08-12-2021 12:42
Re : Pezoloma marchantiae?
Yes, I agree. There are not many similar species on Marchantiales.
Edouard Evangelisti,
08-12-2021 15:34
Georges Greiff,
08-12-2021 15:48
Re : Pezoloma marchantiae?
Fantastic to hear, Edouard, and looking forward to the sequence data.
I think that Jessica Nelson's recent (2018-) papers have published sequences of this in NCBI. Though they may not be labelled as P. marchantiae on there, I expect they will return as top BLAST hits.
Thanks and best wishes,
George
I think that Jessica Nelson's recent (2018-) papers have published sequences of this in NCBI. Though they may not be labelled as P. marchantiae on there, I expect they will return as top BLAST hits.
Thanks and best wishes,
George
Edouard Evangelisti,
16-12-2021 17:44
Re : Pezoloma marchantiae?
Hello Georges,
Please find the ITS sequence of your collection below.
I am going to submit it to NCBI. It would be great if you could send me the details of the collection (it was written on the samples but I am away from the lab right now) and the name of people involved in collection and identification, so they can get credit. The best hit is KY462822 from Zotto.
>P_marchantiae
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTATCCTTCCACGGA
AGCCTGTGTTCCCGCGACTCTAAATACAGGAGCAAGTAGCTAGAAGCTGC
TACATAATCGAACTGCGGGGATCTCCTAAAGCTCCGGCTACTCCCCTACC
GCTGAAAGGTGGTAGGCACAGTAAGAACGCCGGGGATGCGACAATGGACG
ATCCGCAGCCTAGCCCCTACCGTCGTTGACCACGGGGAAGGTTCACAGAC
TAAGTGATTATGGGTAGGGGTCCCCCCTACTTAAGATATAGTCGGTCGGT
TGGCGAGAGCTGACTGCTAGAGACGTTCCGTAGGTGAACCTGCGGAAGGA
TCACTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTGAATACT
ATACCTTCGTTGCTTTGGCAGGCCGTGGAAACACCACCGACCCCGGCTAG
TGCGTGCCTGCCAGAGGAAACACAACTCTGTCTTTAGTGATGTCTGAGTA
CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGG
CATGCCTGTTCGAGCGTCATTTCAACCAATCAAGCCTAGGCTTGGTCTTG
GGTTTGCGGTCTTTCGCACTCCCTAAACTTAGTGGCGGTGCGACTGAGCT
CTGAGCGTAGTAATTCTTCTCGCTATAGGGTCTTGGTCGTGACTTGCCAG
CAACCCCCTCTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGC
TGAACTTAAGCATATCAATAAGCGGAGGA
Best wishes,
Edouard
Please find the ITS sequence of your collection below.
I am going to submit it to NCBI. It would be great if you could send me the details of the collection (it was written on the samples but I am away from the lab right now) and the name of people involved in collection and identification, so they can get credit. The best hit is KY462822 from Zotto.
>P_marchantiae
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTATCCTTCCACGGA
AGCCTGTGTTCCCGCGACTCTAAATACAGGAGCAAGTAGCTAGAAGCTGC
TACATAATCGAACTGCGGGGATCTCCTAAAGCTCCGGCTACTCCCCTACC
GCTGAAAGGTGGTAGGCACAGTAAGAACGCCGGGGATGCGACAATGGACG
ATCCGCAGCCTAGCCCCTACCGTCGTTGACCACGGGGAAGGTTCACAGAC
TAAGTGATTATGGGTAGGGGTCCCCCCTACTTAAGATATAGTCGGTCGGT
TGGCGAGAGCTGACTGCTAGAGACGTTCCGTAGGTGAACCTGCGGAAGGA
TCACTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTGAATACT
ATACCTTCGTTGCTTTGGCAGGCCGTGGAAACACCACCGACCCCGGCTAG
TGCGTGCCTGCCAGAGGAAACACAACTCTGTCTTTAGTGATGTCTGAGTA
CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGG
CATGCCTGTTCGAGCGTCATTTCAACCAATCAAGCCTAGGCTTGGTCTTG
GGTTTGCGGTCTTTCGCACTCCCTAAACTTAGTGGCGGTGCGACTGAGCT
CTGAGCGTAGTAATTCTTCTCGCTATAGGGTCTTGGTCGTGACTTGCCAG
CAACCCCCTCTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGC
TGAACTTAAGCATATCAATAAGCGGAGGA
Best wishes,
Edouard
Georges Greiff,
16-12-2021 17:57
Re : Pezoloma marchantiae?
Hi Edouard,
Great, thank you! Good to see that hits 2-4 (>99%) are Jessica Nelson's "Leotiomycetes sp. 1", which was also P. marchantiae collected from fruitbodies but not identified at the time. Nice to get confirmation.
I have attached a photo the collectors' details and the rest of the voucher information, including UK grid reference. Sorry it is a bit blurry. ID was suggested by me and supported by Enrique Rubio on here.
Thanks again and let me know if you need any other details.
George
Great, thank you! Good to see that hits 2-4 (>99%) are Jessica Nelson's "Leotiomycetes sp. 1", which was also P. marchantiae collected from fruitbodies but not identified at the time. Nice to get confirmation.
I have attached a photo the collectors' details and the rest of the voucher information, including UK grid reference. Sorry it is a bit blurry. ID was suggested by me and supported by Enrique Rubio on here.
Thanks again and let me know if you need any other details.
George
Hans-Otto Baral,
17-12-2021 10:07
Re : Pezoloma marchantiae?
I am sorry I overlooked this thread. Great that a further sequence is available! I see only 1 nt difference in the ITS (ITS1) to Jean-Paul Priou's collection. A remark: There is an error in your sequence at the 3'-end of SSU: must be ATCATTA (you have ATCATA. If you send me the ab1 I will check it.
About nuclei: The central nucleus is only very faintly visible in the photos (in one spore of ERD 8970 and in one of my drawin HB 3445). The striking small dots at the spore ends are LBs.
Zotto
Edouard Evangelisti,
17-12-2021 16:53
Hans-Otto Baral,
17-12-2021 21:58
Re : Pezoloma marchantiae?
No, it is ATCATTA which is very close to the ITS1 primer. It is the highly constant end of SSU where the ITS1-region starts. Of course this is in forward direction as sequences are uploaded in GenBank.
Edouard Evangelisti,
18-12-2021 06:26
Hans-Otto Baral,
18-12-2021 09:02
Re : Pezoloma marchantiae?
Indeed!! In my files I see this mutation in one case only: MN047447 Gelatinopsis exidiophila
Edouard Evangelisti,
18-12-2021 16:27
Re : Pezoloma marchantiae?
Good to know, in the future I will send two clones just in case.
Edouard
Edouard