Accès membres

Mot de passe perdu? S'inscrire

19-05-2026 19:47

Andreas Millinger Andreas Millinger

Hello dear community,found this species the second

19-05-2026 12:55

Hardware Tony Hardware Tony

After checking Gminder and Otto's library I cannot

19-05-2026 10:27

Patrice TANCHAUD

Bonjour, récolte récente sur terre retournée i

18-05-2026 12:43

Sylvie Le Goff

Bonjour à tousPuis je avoir votre aide sur ce que

19-05-2026 14:56

Åge Oterhals

I found this white cushion-formed ascomycete on ro

18-05-2026 19:49

William Slosse William Slosse

Good evening all,recently I found a portion of a S

18-05-2026 10:13

Lieve Deceuninck Lieve Deceuninck

Dear forum members,I identified this as the teleom

17-05-2026 22:09

éric ROMERO éric ROMERO

Bonjour tous, Je sollicite vos avis pour ce Molli

17-05-2026 19:05

Thomas Flammer

I have found this tiny 200 ym cup shaped apothecia

17-05-2026 16:41

Margot en Geert Vullings

We found this Lachnum on an old Rubus stem.Fruitbo

« < 1 2 3 4 5 > »
Ascomycet on old Peniophora quercina
Maren Kamke, 26-04-2021 20:38
Maren Kamke
Hello everybody,

I found this fungus with dark, encrusted, septate hairs, maybe of two kinds on Quercus twigs.

Asci 8-spored with croziers, IKI negative, spores ciborioid.

I'm glad about any help

Thanks

Maren
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
Enrique Rubio, 26-04-2021 20:58
Enrique Rubio
Re : Ascomycet on old Peniophora quercina
Hi Maren
Did you consider the possibility that it is a Dematioscypha? Are there any hyphomycete in the vicinity of the apothecia?
Hans-Otto Baral, 26-04-2021 21:00
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Hi Maren

do you have a photo of the hairs at higher resolution? I am not sure is it a Pyrenopeziza or a Hyphodiscus or ...?

Zotto
Maren Kamke, 26-04-2021 21:23
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Dear Enrique and Zotto,

I saw no Hyphomycetes around the Apothecia.

Here come two more pictures of the hairs and one with Baral'scher solution.

Maren
  • message #68642
  • message #68642
  • message #68642
Hans-Otto Baral, 26-04-2021 21:35
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Ah, these are discrete, not too dense warts! Funny, and not unlike Hyphodiiscus. Anyway I am unsure and cannot remember such a fungus. This definitely excludes a Pyrenopeziza.
Kosonen Timo, 27-04-2021 07:23
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
Hi Maren,

Do you do cultures & sequencing? This could well a member of the Hyphodiscus "family" as suggested. It would be interesting to place this one.

t. Timo
Maren Kamke, 27-04-2021 18:03
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Hi Timo,
unfortunately, as a amateurmycologist I don't do cultures and have only had one fungus sequenced so far, so I haven't any experience with it.
If you are interested, I can send you the fungus for this purpose.
Regards
Maren
Guy Marson, 28-04-2021 21:10
Re : Ascomycet on old Peniophora quercina
Hi Maren and Timo,
 
If you got material from Maren, and if your sequencing is successful, please let me know if it is this species or not:

>Hyphodiscus on Peniophora
ATCATTACCGAGCTCATGCCCTCCGGGGTAGACCTCCCACCCTT
GCTGATTTACCCGTTTGTTGCTTTGGCGGGCCGTCTTCATGGCC
ACCGGCGCCCGGCTGGTGCGCGCCCGCCAGAGACCCCCAAAA
CCCAGTCTGTTTACGTGTCCGTCCGAAACCCATATATAATATTAA
AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC
GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAG
GGGCATGCCTGTCCGAGCGTCATAAACACCACTCAAGCTCCGC
TTGGTACTGGACCGTGCCGGCAACGGCAGGCCCCAAACTCAG
TGGCGGCGCCGCTAGGCTCCGAGCGTAGTACATTCCTCGCTCC
GGGGCCCCCGCGGTTGTCGACCAGCAACCCCCCTACTCTCAAG
TTTGACCT

I will load my sequence of such a species to GB when I have filled a gap of 300 nt in the LSU.

Best regards,

Guy
Kosonen Timo, 29-04-2021 11:12
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
allright. I'll let you know how it goes. ---trying not to draw too much conclusions from ITS seq, but maybe this Guy's sequence is of a non aff. Hyphodiscus species?? It deviates a lot from the median Hyphodiscus seqs. ...an Encoelia???

Timo