22-04-2026 01:06
Bonjour à tous.Je vous présente cette Nectria s.
21-04-2026 22:14
Margot en Geert VullingsThis cup fungus was found on April 10, 2026, on lo
21-04-2026 13:36
Gernot FriebesHi,I am out of ideas for this one. I collected Sal
21-04-2026 13:19
Gernot FriebesHi,this Lophodermium on Typha has ascospores measu
21-04-2026 13:05
Gernot FriebesHi,this hyphomycete feels familiar but I was not a
20-04-2026 22:00
These pale yellow, hairy ascos were growing on cul
19-04-2026 21:23
Steve ClementsBonjour, I found this anamorphic fungus on old pl
19-04-2026 20:46
Steve Clements1 mm diameter approx spherical conidiophores on pl
12-04-2026 17:56
Hardware Tony
Found on dead stems in February earlier this year
Pseudosclerococcum golindoi (det: Zotto)
Danny Newman,
15-12-2025 07:05
Pseudosclerococcum golindoi (det: Zotto)near Cosby Campground, Great Smoky Mountains National Park, Cocke County, Tennessee, USA
Collected during the 2025 Richard P. Korf Memorial North American Ascomycete Foray (aka "The Korf Foray), held at the Appalachian Highlands Science Learning Center in Purchase Knob, North Carolina.
2x ITS sequences were generated from this material, one matching Orbilia dryadum, while the other is very close to Papillospora hebetiseta. both have thus far been considered to be "off-target," as in sequences of a fungus which is not the focus of the collection/observation in question.
only two spores were ever able to be observed outside of asci, as seen in the first micrograph (credit: Connor Dooley). otherwise, photo credits are as follows:
macro photography: Connor Dooley
micrographs: Patrick A Verdier
some comments on microscopy from Patrick:
"The hymenium was embedded in an extracellular gel with odd iodine staining, sometimes maroon (high iodine) sometimes teal (low iodine) suggesting a strange mix of amyloid/dextrinoid, with some carotenoids thrown in. Paraphyses swollen tips included a weird doughnut shaped structure, in fresh specimens at least. Paraphyses tips were also highly absorbent in blue light, and even more so in UV light (using a monochrome camera and UV light source)"
"The hymenium was embedded in an extracellular gel with odd iodine staining, sometimes maroon (high iodine) sometimes teal (low iodine) suggesting a strange mix of amyloid/dextrinoid, with some carotenoids thrown in. Paraphyses swollen tips included a weird doughnut shaped structure, in fresh specimens at least. Paraphyses tips were also highly absorbent in blue light, and even more so in UV light (using a monochrome camera and UV light source)"
crossposted to the Ascomycetes of the World FB group at https://www.facebook.com/groups/ascomycetes/posts/4143399475912225
Hans-Otto Baral,
15-12-2025 08:40
Re : indet. discomycete on wood (unk.)
Hi Danny
this should be Pseudosclerococcum golindoi. The spores in the type measured 10-12 x 4.5-5.5 and were 1-septate.
See paper Olariaga et al. , Mycological Progress (2019) 18:895–905
https://doi.org/10.1007/s11557-019-01500-7
https://doi.org/10.1007/s11557-019-01500-7
Zotto
Danny Newman,
15-12-2025 09:11
Re : indet. discomycete on wood (unk.)
thank you as always, Zotto. I have added this genus and species to the nomenclatural database on iNat and credited you for the determination on the observation. your expertise continues to be without equal. the entire Korf Foray is grateful for your assistance.
Danny Newman,
15-12-2025 12:56
Re : Pseudosclerococcum golindoi (det: Zotto)
one thing I've just noticed:
we generated two, inconclusive sequences from this material, as mentioned in the original post.
they are as follows:
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCAAACTGATAGATTCTTCTGCAGTGACGCCTTTGGAAGCCTTTGTGGCCCCGCAAGGGGTATTCACGGCGACTATAAACAAGAATGTGAGTATTAAATCGCAAGTCGGCCACCAGCGGCCGGCGACACTTTCGAATTGCGGGGAATCCCTAAAGCCCATCTCTACCAACCCGGCGCGGAAACGCGCGGGGGGCCGGTGCTAATCACACCGGGGCGGTAACAATGAGATGGGATAGACAGCATGGGCAATCCGCAGCCAAGTCCCTAAGGCGAGAGCTATGGGAAAGGTTCACAGACTAAGTGGAAGTGGGTTGGGGCCGGTGTGCCCCAGCTTAAGATATAGTCGGGCTTGATGAGAAATCGTCGGGGAGTCACTGGACTAAACATAAACTGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGAAAAGGCTTTGCGCCGGGCCCGTCCCGGACAGAGTTCAACCCTTTGTGAAAAACAACCTTCTTTTCGCTTCGGCAGCTCGCGCTCGCGCGGTCAGCCTGCCGGCAGCACCAAAAATATCAACCTGTCTCTGTAGATAATGTCTGACCATTCTGAATTGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGTCGGCATTCCGACGGGCACGTCTGTCTGAGCGTCATGTCAAATCTCTGCTGGCCTGGGTTTGCGCCCGGTCAGCCGGTACTGAGCTGCGGTCTCCCAACCGGAACTGCGCTTTAAAGTGGCACGCTCTGCGGGTCTGACCGCTTCGAGAACATAGTATAATGCTATCTGTTCCAGGAGCCGGCTCAGGCAACCGCCTGAACAAATCTTCTATTAGGTTTGACCTCAGATCAGACGAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCCTAAACCCTCGTGAACCTACCGAAACGTTGCCTCGGCGGGCGCCCGGCCTCTCGCGCCGGGCGCTGCGCCCGCCGGCGGCCCCCTACTCTGTCTCTGCAGCGTTGGCATCTCCGAGTATATACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCCACCCTCAGGCTCGGCCTGGTGTTGGGGGCCTGCCGCGCGCAGCCCCCGAAAGACAGCGGCGGTCCCGATCCCGGCTCCGAGCGTAGTAATACACGTCGCTCTGGGCGCCTGGCGGGCTTCCAGCCGGAAACCTCACATATCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
they bear a 90-92% similarity to the GenBank accession for the ITS sequence of the type of P. golindoi (https://www.ncbi.nlm.nih.gov/nuccore/MK759885.1).
I wonder, Zotto, if you could comment on the accuracy/usefulness of either of these sequences. I was expecting them to be much more dissimilar to MK759885.1 if they truly belonged to contaminants. Perhaps one of them is "good," and this is merely evidence of significant variation in ITS sequences in this taxon?
they are as follows:
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCAAACTGATAGATTCTTCTGCAGTGACGCCTTTGGAAGCCTTTGTGGCCCCGCAAGGGGTATTCACGGCGACTATAAACAAGAATGTGAGTATTAAATCGCAAGTCGGCCACCAGCGGCCGGCGACACTTTCGAATTGCGGGGAATCCCTAAAGCCCATCTCTACCAACCCGGCGCGGAAACGCGCGGGGGGCCGGTGCTAATCACACCGGGGCGGTAACAATGAGATGGGATAGACAGCATGGGCAATCCGCAGCCAAGTCCCTAAGGCGAGAGCTATGGGAAAGGTTCACAGACTAAGTGGAAGTGGGTTGGGGCCGGTGTGCCCCAGCTTAAGATATAGTCGGGCTTGATGAGAAATCGTCGGGGAGTCACTGGACTAAACATAAACTGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGAAAAGGCTTTGCGCCGGGCCCGTCCCGGACAGAGTTCAACCCTTTGTGAAAAACAACCTTCTTTTCGCTTCGGCAGCTCGCGCTCGCGCGGTCAGCCTGCCGGCAGCACCAAAAATATCAACCTGTCTCTGTAGATAATGTCTGACCATTCTGAATTGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGTCGGCATTCCGACGGGCACGTCTGTCTGAGCGTCATGTCAAATCTCTGCTGGCCTGGGTTTGCGCCCGGTCAGCCGGTACTGAGCTGCGGTCTCCCAACCGGAACTGCGCTTTAAAGTGGCACGCTCTGCGGGTCTGACCGCTTCGAGAACATAGTATAATGCTATCTGTTCCAGGAGCCGGCTCAGGCAACCGCCTGAACAAATCTTCTATTAGGTTTGACCTCAGATCAGACGAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCCTAAACCCTCGTGAACCTACCGAAACGTTGCCTCGGCGGGCGCCCGGCCTCTCGCGCCGGGCGCTGCGCCCGCCGGCGGCCCCCTACTCTGTCTCTGCAGCGTTGGCATCTCCGAGTATATACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCCACCCTCAGGCTCGGCCTGGTGTTGGGGGCCTGCCGCGCGCAGCCCCCGAAAGACAGCGGCGGTCCCGATCCCGGCTCCGAGCGTAGTAATACACGTCGCTCTGGGCGCCTGGCGGGCTTCCAGCCGGAAACCTCACATATCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
they bear a 90-92% similarity to the GenBank accession for the ITS sequence of the type of P. golindoi (https://www.ncbi.nlm.nih.gov/nuccore/MK759885.1).
I wonder, Zotto, if you could comment on the accuracy/usefulness of either of these sequences. I was expecting them to be much more dissimilar to MK759885.1 if they truly belonged to contaminants. Perhaps one of them is "good," and this is merely evidence of significant variation in ITS sequences in this taxon?
Hans-Otto Baral,
15-12-2025 15:24
Re : Pseudosclerococcum golindoi (det: Zotto)
How I do it: Search for ATCATTA and TGACCT and copy the part between (wihich is ITS and 5.8S) into GenBank Blast search.
The first sequence gives 99.6% Orbilia dryadum. So this is clearly this Orbilia species.
The second gives with 98.5% Papillospora henetiseta (Chaetosphaeriaceae).
In the alignment of Sclerococcales I saw at once that it is something different.













