17-11-2025 21:46
Philippe PELLICIERBonjour,Récolté sur bois pourrissant de feuillu
19-11-2025 13:04
Bruno Coué
Bonjour,je sollicite votre avis pour la récote
16-11-2025 21:09
Robin Isaksson
Anyone recognize this acc. to pictures.? Found on
18-11-2025 13:59
Nogueira HéctorNovember 14, 2025 Brazuelo (León) SPAIN Hymenosc
17-11-2025 19:14
herman lambertApothécie discoïde 0.6 cm diam., orangeFace hymÃ
17-11-2025 21:57
Philippe PELLICIERBonjour,Récolté sur bois de feuillu mort dur, no
14-11-2025 16:26
Marian Jagers
Hello everyone, On dead wood of Cytisus scoparius
15-11-2025 23:22
Mario FilippaHello,this is what I think to be Hymenoscyphus mac
15-11-2025 20:25
Riet van Oosten
Hello, Found by Laurens van der Linde, Nov. 2025
Pyrenopeziza lignicolous IKI-
Viktorie Halasu,
24-12-2021 12:02
Hello,wish you a merry christmas!Â
In case someone drops by, I have this small Pyrenopeziza(?), on a piece of bark stuck 1m above ground between branches, on its inner side. The tree is Crataegus, I'm not sure about the piece of bark.
Asci seem inamyloid, mostly inflated with a narrow base.
Paraphyses cylindrical, VB-, not reacting in Baral's either.
Only short brownish clavate cells on the margin.
Soc. Orbilia xanthoguttulata. A row of trees between railroad and a field, riparian forest nearby.
Am I in a correct genus? I've seen just a few lignicolous species in Bernard's key and neither was a good match. Maybe it froze a bit overnight, perhaps a damaged Mollisia would be a possibility too?
Thank you in advance.
Viktorie
Enrique Rubio,
24-12-2021 12:17
Re : Pyrenopeziza lignicolous IKI-
Hi Viktorie
Close to Pyrenopeziza caespiticia?
Close to Pyrenopeziza caespiticia?
Viktorie Halasu,
24-12-2021 12:27
Re : Pyrenopeziza lignicolous IKI-
Hello Enrique,Â
that was one of the names I checked, but I haven't seen such long marginal cells in my fungus and I don't know if the paraphyses and marginal cells can loose VBs entirely when the rest of hymenium is alive.Â
But this Piotr's collection seems to be close:Â http://ascofrance.com/search_forum/3296
Viktorie
that was one of the names I checked, but I haven't seen such long marginal cells in my fungus and I don't know if the paraphyses and marginal cells can loose VBs entirely when the rest of hymenium is alive.Â
But this Piotr's collection seems to be close:Â http://ascofrance.com/search_forum/3296
Viktorie
Hans-Otto Baral,
24-12-2021 12:39
Re : Pyrenopeziza lignicolous IKI-
I have also no other suggestion. The species is a bit difficult and can easily be misidentified. Nick Aplin wanted in a manuscript to describe a British collection as a new species but I considered it to be P. caespiticia. His unpublished sequence and another by Ingo Wagner/Florian Prell are quite close to each other. But Guy's sequence KY965813 is very distant and I tend to believe that it is Calycina vulgaris.
Enrique Rubio,
24-12-2021 12:49
Re : Pyrenopeziza lignicolous IKI-
This fungus appears to be xero-tolerant. In my region this fungus is particularly abundant on Malus branches still attached to the tree. But I never see it on the ones that have fallen to the ground, unless they have fallen after a windstorm.
Michel Hairaud,
24-12-2021 15:07
Re : Pyrenopeziza lignicolous IKI-
Bonjour les amis,Â
I Used to call this species Mollisia caespiticia , particularly because of the mollisioid paraphyses contents (long VBs staining in CRB)Â
Is it based on molecular analysis that you now consider it as a Pyrenopeziza ?Â
Amitiés
Michel
I Used to call this species Mollisia caespiticia , particularly because of the mollisioid paraphyses contents (long VBs staining in CRB)Â
Is it based on molecular analysis that you now consider it as a Pyrenopeziza ?Â
Amitiés
Michel
Hans-Otto Baral,
24-12-2021 15:42
Re : Pyrenopeziza lignicolous IKI-
There occur low-refractive VBs indeed.
The two sequences of M. caespiticia cluster supported with Heterosphaeria patella! That is no Mollisiaceae but akin to Pyrenopeziza. Several Pyrenopeziza spp. cluster more distantly and with less support with these.
Earlier I thought that M. caespiticia is related to M. ligni but it isn't.
Michel Hairaud,
24-12-2021 17:47
Re : Pyrenopeziza lignicolous IKI-
Merci Zotto,Â
Is there a paper I missed in which it has already been published ?Â
IF still keeps Mollisia as current generic name
Michel
Is there a paper I missed in which it has already been published ?Â
IF still keeps Mollisia as current generic name
Michel
Nick Aplin,
25-12-2021 01:49
Re : Pyrenopeziza lignicolous IKI-
Season's greetings everybody,
I didn't publish anything, although I finally came to the conclusion my collections were better refered to as 'Mollisia' caespiticia rather than anything new. Much of the collection data is available in Zotto's Google Drive folders:
Helotiales -> Ploettnerulaceae -> Pyrenopeziza on wood and bark -> caespiticia 4.5-8.5 x 1.5-2 IKI- -> Helotiales 28-IV-2020
As Zotto suggests, the ITS sequence seemed to belong in Heterosphaeraceae rather than anywhere near Mollisia or Pyrenopeziza:
>Helotiales_sp_LGW_28.IV.2020_Salix_Branch
TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTTTTGCCCTAACGGGTAGATCTCCCACCCTTGAATACATACCTTTGTTGCTTTGGCGGGCCGCGCTCGCGCTACTGGCTTGTCTAGTACGTGCCCGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTATACCACTCAAGCTCAGCTTGGTATTGGGGCCCGCCCACCAGCGGCCCCTAAAGTCAGTGGCGGTGCCGGTCGGCTCTAAGCGTAGTAATACTCCTCGCTATAGGGTCCGGTCGGTTGCTTGCCAACAACCCCAAATTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
This collection seems identical to mine except for the slightly wider spores.
Amités,
Nick
I didn't publish anything, although I finally came to the conclusion my collections were better refered to as 'Mollisia' caespiticia rather than anything new. Much of the collection data is available in Zotto's Google Drive folders:
Helotiales -> Ploettnerulaceae -> Pyrenopeziza on wood and bark -> caespiticia 4.5-8.5 x 1.5-2 IKI- -> Helotiales 28-IV-2020
As Zotto suggests, the ITS sequence seemed to belong in Heterosphaeraceae rather than anywhere near Mollisia or Pyrenopeziza:
>Helotiales_sp_LGW_28.IV.2020_Salix_Branch
TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTTTTGCCCTAACGGGTAGATCTCCCACCCTTGAATACATACCTTTGTTGCTTTGGCGGGCCGCGCTCGCGCTACTGGCTTGTCTAGTACGTGCCCGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTATACCACTCAAGCTCAGCTTGGTATTGGGGCCCGCCCACCAGCGGCCCCTAAAGTCAGTGGCGGTGCCGGTCGGCTCTAAGCGTAGTAATACTCCTCGCTATAGGGTCCGGTCGGTTGCTTGCCAACAACCCCAAATTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
This collection seems identical to mine except for the slightly wider spores.
Amités,
Nick
Hans-Otto Baral,
25-12-2021 08:33
Re : Pyrenopeziza lignicolous IKI-
Thanks Nick! In order to obtain a better insight, it is generally useful to compile the available data of samples and to see how far the variation goes. But it is alwaya dangerous when doing a joint description to include finds of different species. So far I did not try.






