Accès membres

Mot de passe perdu? S'inscrire

15-05-2016 02:06

Alan Rockefeller Alan Rockefeller

Hi - I recently sequenced one of my collections f

14-05-2016 10:57

Elisabeth Stöckli

Bonjour, Trouvé au sol, sur feuille d' Andromeda

13-05-2016 21:07

Enrique Rubio Enrique Rubio

Please, could you help me with this paper? Fungi

14-05-2016 15:00

Blasco Rafael Blasco Rafael

Hola, les parece que sea la que propongo, las medi

20-08-2014 21:35

Marja Pennanen

Hello folks,these beautyful ascos grow on a river

24-01-2011 01:21

Erwin Gruber

I posted the following entry at the item "sur prel

12-05-2016 23:08

Castillo Joseba Castillo Joseba

En madera de haya (Fagus)Alguna sugerencia?Joseba

13-05-2016 15:19

Castillo Joseba Castillo Joseba

No se como pero he bloqueado los correos de Ascofr

12-05-2016 23:05

Castillo Joseba Castillo Joseba

Ascomiceto en forma de discos blancos,  en madera

09-05-2016 12:36

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Hello,I would be very glad if someone could send m

« < 890 891 892 893 894 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto