Accès membres

Mot de passe perdu? S'inscrire

12-06-2026 14:50

Mollisia revincta (?)
François Freléchoux François Freléchoux

Bonjour, Voici la brève description d'une Mollis

10-06-2026 21:16

Ascomycète stipité sp. sur Filipendula ulmaria
François Freléchoux François Freléchoux

Bonsoir,Le dernier du jour, en attendant votre avi

11-06-2026 16:24

Orbilia
Ethan Crenson

Hi all, Recently, a friend found this Orbilia in

11-06-2026 19:01

Spinellus-like fungus on Scathophaga stercoraria
William Slosse William Slosse

Hello all,In an attempt to make a culture of a sus

11-06-2026 19:03

IMPORTANT >> MAINTENANCE 15-06
Nicolas VAN VOOREN Nicolas VAN VOOREN

Chers membres d'Ascofrance,Le site sera placé en

10-06-2026 23:08

Mollisia nervicola ?
éric ROMERO éric ROMERO

Bonjour tous, Je vous propose un Mollisia trouvé

09-06-2026 18:32

Vibrisseaceae(?) sur phragmites
Camille Mertens

Sur morceau de roseau immergé 0,5 - 0,7 mm de dia

10-06-2026 12:54

A dematiaceous hyphomycete on Filipendula
Steve Clements

Bonjour encore, Pouvez-vous m'aider, s'il vous pl

10-06-2026 21:07

Pyrénomycète ? sur Gentiana lutea
François Freléchoux François Freléchoux

Toutes les tiges de gentianes jaunes de l'an passÃ

10-06-2026 13:41

Ascomycète sp. sur Gentiana lutea
François Freléchoux François Freléchoux

Bonjour à nouveau, Voici une trouvaille d'hier.

« < 1 2 3 4 5 > »
Asco on Carex nigra
Simon Gurtner, 22-12-2024 10:19
Simon GurtnerHello,

can anyone help me identify this small ascomycete?

Found on 01.08.2024 in the Swiss Alps at 2220 m above sea level on Carex nigra.
So far, I have not been able to determine even the genus. Allophylaria is one idea. However, this could not be confirmed by sequencing.

I wish everyone a Merry Christmas and a Happy New Year.

Best regards,
Simon

Here is the sequencing:
AAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGCTCATGCCCCCCGGGGTAGAACTCCACCCTTGCTTGTGCTACCTAGTTGCTTTGGCAGGCCGCTGGCCTACCGTGCCGTGCCTGCCAGAGGTTCTAAACTCGTGTCTCTGAAATCGTCTGAGTAAT ACAAAATTGAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTAGGTATTCCTGGGGGCATGCCTGTCCGAGCGTCATTAAACACCACTCA AGCTCCGCTTGGTCCTGGGGCGCGCTAGATTTCTAGCGCTCCCTAAACTCAGTGGCGGCGGCTCTCGACCCTCCAGCGCAGTATAACACCTCGCTATGAGATCGGGATCCGCTGGCCAGCAAGCACTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
  • message #81069
Lothar Krieglsteiner, 22-12-2024 10:22
Lothar Krieglsteiner
Re : Asco on Carex nigra
why not a Cyathicula? Sometimes it helps to have spores, the reaction of the ascus apex with IKI and some further details.
Simon Gurtner, 22-12-2024 10:35
Simon Gurtner
Re : Asco on Carex nigra
Hi Lothar, when I created the thread, I uploaded the data before I was finished. I have added the missing images. Cyathicula was my first thought macroscopically. However, the microscopy does not fit.
Lothar Krieglsteiner, 22-12-2024 10:45
Lothar Krieglsteiner
Re : Asco on Carex nigra
Hello Simon,
ah - I was too fast. Now I see spores - but still not the ascus-apes in IKI. In Allophylaria it ist often (not always) reacting hemiamyloid.
What I already saw are guttulate (dying?) paraphyses what fits for Cyathicula - and for Hymenoscyphus. The excipulum seems more a prismatica than oblita, so o.k. better a Hymenoscyphus. The spores would fit here also better.
Yours, Lothar
Stip Helleman, 22-12-2024 12:51
Stip Helleman
Re : Asco on Carex nigra
Hi Simon,

to me it looks also as a Cyathicula/Hymenoscyphus, only the sequence does not make any sense. There is no attachment to Helotiaceae in the Multiple sequence ML tree.

Herzliche Gruessen, Frohe Weihnachten und ein gute Rutsch

Stip
  • message #81080
  • message #81080
Simon Gurtner, 22-12-2024 15:34
Simon Gurtner
Re : Asco on Carex nigra
Hallo Lothar, Hallo Stipe

Danke für eure Hilfe. Zu Beginn habe ich in der Ecke gesucht, bin aber auf kein Ergebniss gekommen. Ich werde es noch einmal da versuchen. Die Sequenz verwirrt mich mehr als es mir hilft. 

Grüsse, Simon
Hans-Otto Baral, 22-12-2024 16:23
Hans-Otto Baral
Re : Asco on Carex nigra
My guess was Cyathicula macrospora, and I remember a negative IKI reaction of the asci. I think the sequence is a contamination.
Simon Gurtner, 22-12-2024 17:55
Simon Gurtner
Re : Asco on Carex nigra
Hallo Zotto,

unter Cyathicula macrospora kann ich nichts finden. Meinst du Allophylaria macrospora?

Grüsse, Simon
Simon Gurtner, 22-12-2024 18:35
Simon Gurtner
Re : Asco on Carex nigra
... oder Cythicula megalospora? da hänge ich gerade im Schlüssel
Hans-Otto Baral, 22-12-2024 18:40
Hans-Otto Baral
Re : Asco on Carex nigra
Sorry, ja, megalospora
Simon Gurtner, 22-12-2024 19:04
Simon Gurtner
Re : Asco on Carex nigra
Vielen Dank euch allen :)