05-02-2026 15:07
Found on a fallen needle of Pinus halepensis, diam
05-02-2026 06:43
Stefan BlaserHello everybody, Any help on this one would be mu
18-08-2025 15:07
Lothar Krieglsteiner
.. 20.7.25, in subarctic habital. The liverwort i
02-02-2026 21:46
Margot en Geert VullingsOn a barkless poplar branch, we found hairy discs
02-02-2026 14:55
Andgelo Mombert
Bonjour,Sur thalle de Lobaria pulmonaria.Conidiome
02-02-2026 14:33
Andgelo Mombert
Bonjour,Sur le thalle de Peltigera praetextata, ne
31-01-2026 10:22
Michel Hairaud
Bonjour, Cette hypocreale parasite en nombre les
02-02-2026 09:29
Bernard CLESSE
Bonjour à toutes et tous,Pour cette récolte de 2
01-02-2026 19:29
Nicolas Suberbielle
Bonjour, Marie-Rose D'Angelo (Société Mycologiq
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto

Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf