Accès membres

Mot de passe perdu? S'inscrire

21-05-2016 09:45

Elisabeth Stöckli

Bonjour,Trouvé au sol sur branches cortiquées de

23-05-2016 17:07

Lepista Zacarias

Hi everyone,If I understood correctly the explanat

23-05-2016 14:30

Elisabeth Stöckli

Bonjour,Je suis à la recherche de cette publicati

23-05-2016 13:03

Dragiša Savic

Hello everyone,I found this Niesslia species on de

23-05-2016 11:30

Jacques Fournier Jacques Fournier

Hello forum,This ascomycete intrigues me. I found

22-05-2016 20:56

Enrique Rubio Enrique Rubio

Hi to everybody This fungus was collected on smal

22-05-2016 20:25

Illescas Tomás Illescas Tomás

Buenas tardes a todos:En la misma hoja de Quercus

22-05-2016 19:09

Castillo Joseba Castillo Joseba

En hoja de Castaño,   junto con Coccomyces delt

22-05-2016 10:34

Bernard CLESSE Bernard CLESSE

Bonjour à tous,Voici un asco qui me fait penser Ã

22-05-2016 14:24

Illescas Tomás Illescas Tomás

Hola a todos:Adjunto imágenes de una recolecta de

« < 888 889 890 891 892 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto